Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506464

Morpholino Name: dll1 MO1
Synonyms:
Target mRNA: dll1

Morpholino Type: translation blocking morpholino
Sequence: 5' CCAGGAGAGCCGTAACCGACCCATG 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
Publications
First: Evolutionary plasticity of developmental gene regulatory network architecture., Proc Natl Acad Sci U S A 2007  
Most recent:
View All Papers