Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24505937

Morpholino Name: dicer1 MO1
Synonyms:
Target mRNA: dicer1

Morpholino Type: translation blocking morpholino
Sequence: 5' GGACTCGATGGTGGCTCATCCATTC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci
Identities 25/25
genomic

MO
5' GAATGGATGAGCCACCATCGAGTCC 3' ||||||||||||||||||||||||| 3' CTTACCTACTCGGTGGTAGCTCAGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145611.1:12818502..12818526 25/25 Antisense target dicer1
Publications
First: The 3''UTR of nanos2 directs enrichment in the germ cell lineage of the sea urchin., Dev Biol 2013  
Most recent: microRNAs regulate β-catenin of the Wnt signaling pathway in early sea urchin development., Dev Biol 2015  
View All Papers