Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24505910

Morpholino Name: dll1 MO5
Synonyms: delta
Target mRNA: dll1

Morpholino Type: translation blocking morpholino
Sequence: 5' ATAACATATAGCACGCCGAGAAGGC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
Publications
First: Notch-mediated lateral inhibition is an evolutionarily conserved mechanism patterning the ectoderm in echinoids., Dev Genes Evol 2018  
Most recent: Conserved regulatory state expression controlled by divergent developmental gene regulatory networks in echinoids., Development 2018  
View All Papers