Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24505907

Morpholino Name: dll1 MO2
Synonyms:
Target mRNA: dll1

Morpholino Type: translation blocking morpholino
Sequence: 5' GCCGATCCGTTATTCCTTTCTTATC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci
Identities 25/25
genomic

MO
5' GATAAGAAAGGAATAACGGATCGGC 3' ||||||||||||||||||||||||| 3' CTATTCTTTCCTTATTGCCTAGCCG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145611.1:35186020..35186044 25/25 Antisense target dll1
NW_022145517.1:17256..17280 25/25 Antisense off-target LOC115921237
Publications
First: Gene regulatory network interactions in sea urchin endomesoderm induction., PLoS Biol 2009                          
Most recent:
View All Papers