Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-gRNA-26395100

gRNA Name: LOC588806 gRNA21
Synonyms: SpPKS1 547
Genomic Target: LOC588806

Sequence: 5' GGTGAGGGGTTTGAGGACAA 3'



Genomic Target S. purpuratus A. planci P. miniata L. variegatus
Identities 19/20
genomic

gRNA
5' TTGTCCTCAAACCCCTCAGC 3' |||||||||||||||||| | 3' AACAGGAGTTTGGGGAGTGG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
S. purpuratus 5.0 NW_022145610.1:2716401..2716420 19/20 1 Antisense target LOC588806
NW_022145612.1:15987739..15987758 19/20 2 Antisense off-target LOC105439527
NW_022145614.1:25636822..25636841 16/20 3 Sense off-target LOC100889855
P. miniata 3.0 NW_024037058.1:2801085..2801104 17/20 4 Antisense off-target drg1
NW_024037065.1:4821181..4821200 17/20 5 Antisense off-target LOC119733870
NW_024037053.1:568267..568286 16/20 6 Sense off-target LOC119722309
NW_024037059.1:28824587..28824606 16/20 7 Antisense off-target LOC119728508
NW_024037072.1:6629404..6629423 16/20 8 Sense off-target LOC119742120
XR_005271529.1:1191..1210 16/20 9 Sense off-target LOC119732247
XR_005271530.1:536..555 16/20 10 Sense off-target LOC119732247
XR_005271531.1:503..522 16/20 11 Sense off-target LOC119732247
XR_005271532.1:353..372 16/20 12 Sense off-target LOC119732247
XR_005271533.1:354..373 16/20 13 Sense off-target LOC119732247
XR_005271534.1:392..411 16/20 14 Sense off-target LOC119732247
XR_005271535.1:1145..1164 16/20 15 Sense off-target LOC119732247
XR_005271536.1:912..931 16/20 16 Sense off-target LOC119732247
XR_005271537.1:455..474 16/20 17 Sense off-target LOC119732247
XR_005271538.1:309..328 16/20 18 Sense off-target LOC119732247
XR_005271539.1:904..923 16/20 19 Sense off-target LOC119732247
XR_005271540.1:321..340 16/20 20 Sense off-target LOC119732247
XR_005271541.1:474..493 16/20 21 Sense off-target LOC119732247
XR_005271542.1:455..474 16/20 22 Sense off-target LOC119732247
XR_005271543.1:469..488 16/20 23 Sense off-target LOC119732247
XR_005271544.1:307..326 16/20 24 Sense off-target LOC119732247
XR_005271545.1:345..364 16/20 25 Sense off-target LOC119732247
NW_024037052.1:12976597..12976616 18/20 26 unknown
NW_024037074.1:13702935..13702954 18/20 27 unknown
NW_024037063.1:3401596..3401615 17/20 28 unknown
NW_024037071.1:12210602..12210621 17/20 29 unknown
NW_024037072.1:5113780..5113799 17/20 30 unknown
NW_024037074.1:20570421..20570440 17/20 31 unknown
L. variegatus 3.0 chr12:29614147..29614166 18/20 32 Sense off-target LOC121425375
chr12:32200426..32200445 18/20 33 Sense off-target LOC121424943
chr9:5931373..5931392 18/20 34 Antisense off-target LOC121421003
chr16:13286978..13286997 17/20 35 unknown
chr2:17980091..17980110 17/20 36 unknown
chr14:19620009..19620028 16/20 37 unknown
chr18:18398990..18399009 16/20 38 unknown
chr6:15915435..15915454 16/20 39 unknown
chr6:16890444..16890463 16/20 40 unknown
Publications
First: Optimizing CRISPR/Cas9-based gene manipulation in echinoderms., Dev Biol 2022  
Most recent:
View All Papers