Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-gRNA-26395077

gRNA Name: LOC586240 gRNA1
Synonyms: SpFmo3 225
Genomic Target: LOC586240

Sequence: 5' GGCGGACAGTCCTTGGGGAA 3'



Genomic Target S. purpuratus A. planci P. miniata L. variegatus
Identities 20/20
genomic

gRNA
5' TTCCCCAAGGACTGTCCGCC 3' |||||||||||||||||||| 3' AAGGGGTTCCTGACAGGCGG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
S. purpuratus 5.0 NW_022145610.1:35289827..35289846 20/20 1 Antisense target LOC586240
NW_022145599.1:33251360..33251379 17/20 2 Sense off-target egf1
NW_022145604.1:6512058..6512077 17/20 3 Sense off-target bindin
NW_022145570.1:2190899..2190918 16/20 4 Sense off-target LOC115918009
P. miniata 3.0 NW_024037076.1:9802692..9802711 18/20 5 Antisense off-target LOC119720207
NW_024037065.1:5840593..5840612 17/20 6 Antisense off-target LOC119733901
NW_024037074.1:19742203..19742222 16/20 7 Antisense off-target LOC119746271
NW_024037065.1:1861007..1861026 17/20 8 unknown
NW_024037072.1:38193598..38193617 17/20 9 unknown
L. variegatus 3.0 chr1:33135036..33135055 18/20 10 Sense off-target yipf6
chr7:11509605..11509624 16/20 11 Sense off-target xrcc3
chr3:32044413..32044432 18/20 12 Sense off-target LOC121410784
chr1:40479988..40480007 17/20 13 unknown
Publications
First: Optimizing CRISPR/Cas9-based gene manipulation in echinoderms., Dev Biol 2022  
Most recent:
View All Papers