Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-gRNA-26395076

gRNA Name: LOC580458 gRNA3
Synonyms: Spmesh 450
Genomic Target: LOC580458

Sequence: 5' GGCTAAAGTCGACATTGCTC 3'



Genomic Target S. purpuratus A. planci P. miniata L. variegatus
Identities 19/20
genomic

gRNA
5' GAGCAATGTCGACTTTAGCG 3' ||||||||||||||||||| 3' CTCGTTACAGCTGAAATCGG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
S. purpuratus 5.0 NW_022145594.1:28423738..28423757 19/20 1 Antisense target LOC580458
NW_022145615.1:32754741..32754760 17/20 2 Sense off-target mef2cl
NW_022145594.1:28279382..28279401 18/20 3 Antisense off-target LOC589327
NW_022145594.1:28385902..28385921 18/20 4 Antisense off-target LOC586294
NW_022145544.1:1839518..1839537 17/20 5 Antisense off-target LOC755676
NW_022145612.1:44270441..44270460 17/20 6 Antisense off-target LOC115919281
P. miniata 3.0 NW_024037057.1:7905638..7905657 16/20 7 unknown
L. variegatus 3.0 chr1:10176425..10176444 18/20 8 Sense off-target LOC121425588
chr12:7504605..7504624 16/20 9 Antisense off-target LOC121425559
chr13:29494863..29494882 16/20 10 Antisense off-target LOC121426423
Publications
First: Optimizing CRISPR/Cas9-based gene manipulation in echinoderms., Dev Biol 2022  
Most recent: Identification of the genes encoding candidate septate junction components expressed during early development of the sea urchin, Strongylocentrotus purpuratus, and evidence of a role for Mesh in the formation of the gut barrier., Dev Biol 2022  
View All Papers