Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-gRNA-26395073

gRNA Name: LOC580458 gRNA1
Synonyms: Spmesh 306
Genomic Target: LOC580458

Sequence: 5' GGACGGGCGAATTGAGGACC 3'



Genomic Target S. purpuratus A. planci P. miniata L. variegatus
Identities 19/20
genomic

gRNA
5' GGTCCTCAATTCGCCCGTCG 3' ||||||||||||||||||| 3' CCAGGAGTTAAGCGGGCAGG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
S. purpuratus 5.0 NW_022145594.1:28423591..28423610 19/20 1 Sense target LOC580458
NW_022145594.1:28205545..28205564 19/20 2 Sense off-target LOC105439366
NW_022145594.1:28239869..28239888 19/20 3 Sense off-target LOC115921309
NW_022145594.1:28319664..28319683 18/20 4 Sense off-target LOC115918445
NW_022145615.1:732201..732220 18/20 5 unknown
Publications
First: Optimizing CRISPR/Cas9-based gene manipulation in echinoderms., Dev Biol 2022  
Most recent: Identification of the genes encoding candidate septate junction components expressed during early development of the sea urchin, Strongylocentrotus purpuratus, and evidence of a role for Mesh in the formation of the gut barrier., Dev Biol 2022  
View All Papers