Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-gRNA-26395068

gRNA Name: foxy gRNA3
Synonyms: SpFoxY 224
Genomic Target: foxy

Sequence: 5' GGCAGCCTTTGTAGGATGTT 3'



Genomic Target S. purpuratus A. planci P. miniata L. variegatus
Identities 19/20
genomic

gRNA
5' AACATCCTACAAAGGCTGGC 3' |||||||||||||||||| | 3' TTGTAGGATGTTTCCGACGG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
S. purpuratus 5.0 NW_022145615.1:4516709..4516728 19/20 1 Antisense target foxy
NW_022145570.1:610556..610575 19/20 2 Sense off-target LOC575057
NW_022145610.1:24509344..24509363 16/20 3 Antisense off-target LOC588537
NW_022145599.1:31416681..31416700 19/20 4 Sense off-target LOC115918603
NW_022145615.1:3766304..3766323 19/20 5 Antisense off-target LOC115920611
NW_022145601.1:26341204..26341223 18/20 6 Sense off-target LOC115918697
NW_022145610.1:24524976..24524995 16/20 7 Antisense off-target LOC115929149
NW_022145558.1:919443..919462 17/20 8 unknown
NW_022145600.1:11627867..11627886 17/20 9 unknown
NW_022145603.1:19416091..19416110 17/20 10 unknown
NW_022145613.1:32059585..32059604 16/20 11 unknown
P. miniata 3.0 NW_024037059.1:18454028..18454047 18/20 12 Sense off-target tgm1
NW_024037059.1:35304540..35304559 16/20 13 Antisense off-target uckl1
NW_024037073.1:4213179..4213198 16/20 14 Antisense off-target wdr20
NW_024037065.1:6178205..6178224 18/20 15 Antisense off-target mycbp2
NW_024037059.1:18454028..18454047 18/20 16 Antisense off-target LOC119727709
NW_024037071.1:6502859..6502878 18/20 17 Sense off-target LOC119739847
NW_024037071.1:7348754..7348773 17/20 18 Antisense off-target LOC119739687
NW_024037058.1:5822740..5822759 18/20 19 unknown
NW_024037048.1:9770745..9770764 16/20 20 unknown
NW_024037069.1:5480597..5480616 16/20 21 unknown
L. variegatus 3.0 chr4:39644665..39644684 18/20 22 unknown
chr18:23275441..23275460 17/20 23 unknown
chr19:17869496..17869515 17/20 24 unknown
Publications
First: Optimizing CRISPR/Cas9-based gene manipulation in echinoderms., Dev Biol 2022  
Most recent:
View All Papers