Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-26394981

Morpholino Name: LOC576611 MO3
Synonyms:
Target mRNA: LOC576611

Morpholino Type: control morpholino (5' UTR)
Sequence: 5' CCTCTTACCTCAGTTACAATTTATA 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
Publications
First: An early global role for Axin is required for correct patterning of the anterior-posterior axis in the sea urchin embryo., Development 2021                    
Most recent:
View All Papers