Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-26394980

Morpholino Name: LOC576611 MO2
Synonyms: LvAxinMO
Target mRNA: LOC576611

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' ACCTATACACTTCCAAACTCATGGT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 22/25
genomic

MO
5' ATCATGAGTCTAGAAGTGTATAGGT 3' | ||||||| | ||||||||||||| 3' TGGTACTCAAACCTTCACATATCCA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145599.1:22687575..22687599 22/25 Antisense target LOC576611
NW_022145542.1:1024937..1024961 22/25 Sense off-target LOC115924050
NW_022145612.1:31506538..31506562 22/25 Sense off-target LOC100890359
L. variegatus 3.0 chr10:36425772..36425796 25/25 Antisense off-target LOC446201
chr15:2175271..2175295 21/25 Sense off-target LOC121429149
Publications
First: An early global role for Axin is required for correct patterning of the anterior-posterior axis in the sea urchin embryo., Development 2021                    
Most recent:
View All Papers