Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24529707

Morpholino Name: LOC373520 MO1
Synonyms: Hp-Htt-MO
Target mRNA: LOC373520

Morpholino Type: translation blocking morpholino
Sequence: 5' TATTGCCTTTGAGATAAATCTTCAT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145597.1:13155270..13155294 21/25 Sense off-target LOC575825
NW_022145601.1:7753300..7753324 21/25 Sense off-target LOC115924480
NW_022145610.1:16708626..16708650 22/25 unknown
NW_022145599.1:8200539..8200563 21/25 unknown
NW_022145610.1:16966092..16966116 21/25 unknown
NW_022145610.1:34584089..34584113 21/25 unknown
Publications
First: Involvement of Huntingtin in Development and Ciliary Beating Regulation of Larvae of the Sea Urchin, Hemicentrotus pulcherrimus., Int J Mol Sci 2021                
Most recent:
View All Papers