Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506493

Morpholino Name: tgif2l MO3
Synonyms:
Target mRNA: tgif2l

Morpholino Type: translation blocking morpholino
Sequence: 5' CGTATGTTGACTTTTTCGCAGTGTT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145599.1:17007611..17007635 21/25 1 Sense off-target LOC753699
NW_022145599.1:17008095..17008119 21/25 2 Sense off-target LOC753699
NW_022145599.1:17008580..17008604 21/25 3 Sense off-target LOC753699
NW_022145599.1:17009065..17009089 21/25 4 Sense off-target LOC753699
NW_022145599.1:17009550..17009574 21/25 5 Sense off-target LOC753699
NW_022145599.1:17010503..17010527 21/25 6 Sense off-target LOC753699
NW_022145599.1:17010987..17011011 21/25 7 Sense off-target LOC753699
NW_022145599.1:17011472..17011496 21/25 8 Sense off-target LOC753699
NW_022145599.1:17011957..17011981 21/25 9 Sense off-target LOC753699
NW_022145599.1:17013395..17013419 21/25 10 Sense off-target LOC753699
NW_022145599.1:17013880..17013904 21/25 11 Sense off-target LOC753699
NW_022145599.1:17014365..17014389 21/25 12 Sense off-target LOC753699
NW_022145599.1:17015318..17015342 21/25 13 Sense off-target LOC753699
NW_022145599.1:17015802..17015826 21/25 14 Sense off-target LOC753699
NW_022145599.1:17016287..17016311 21/25 15 Sense off-target LOC753699
NW_022145599.1:16923293..16923317 21/25 16 Sense off-target LOC115923511
NW_022145599.1:16925242..16925266 21/25 17 Sense off-target LOC115923511
NW_022145599.1:17058135..17058159 21/25 18 Sense off-target LOC115923513
NW_022145599.1:17058135..17058159 21/25 19 Sense off-target LOC115923795
NW_022145599.1:17059232..17059256 21/25 20 Sense off-target LOC115923513
Publications
First: Sub-circuits of a gene regulatory network control a developmental epithelial-mesenchymal transition., Development 2014  
Most recent:
View All Papers