Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506489

Morpholino Name: sfrp5 MO4
Synonyms: sFRP-1 MO2
Target mRNA: sfrp5

Morpholino Type: splice blocking morpholino
Sequence: 5' CGGAAGATATTATAGGCATACCTGT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145594.1:747095..747119 25/25 Antisense off-target sfrpl
NW_022145559.1:536813..536837 25/25 Antisense off-target LOC115917869
NW_022145594.1:18699690..18699714 21/25 unknown
NW_022145598.1:14100607..14100631 21/25 unknown
Publications
First: A novel gene''s role in an ancient mechanism: secreted Frizzled-related protein 1 is a critical component in the anterior-posterior Wnt signaling network that governs the establishment of the anterior neuroectoderm in sea urchin embryos., Evodevo 2018              
Most recent:
View All Papers