Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506467

Morpholino Name: efnb1 MO4
Synonyms:
Target mRNA: efnb1

Morpholino Type: translation blocking morpholino
Sequence: 5' CTCCAGGGTCAAAGTGCTCAGGTAT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145606.1:12050888..12050912 25/25 Antisense off-target LOC115927223
NW_022145606.1:10078769..10078793 25/25 unknown
Publications
First: Eph-Ephrin signaling and focal adhesion kinase regulate actomyosin-dependent apical constriction of ciliary band cells., Development 2014  
Most recent: Eph and Ephrin function in dispersal and epithelial insertion of pigmented immunocytes in sea urchin embryos., Elife 2016                
View All Papers