Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506455

Morpholino Name: P16 MO1
Synonyms:
Target mRNA: P16

Morpholino Type: translation blocking morpholino
Sequence: 5' GGTCTTCATAGTAATAGTGTGTGTA 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 25/25
genomic

MO
5' TACACACACTATTACTATGAAGACC 3' ||||||||||||||||||||||||| 3' ATGTGTGTGATAATGATACTTCTGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145615.1:10667063..10667087 25/25 Antisense target P16
Publications
First: P16 is an essential regulator of skeletogenesis in the sea urchin embryo., Dev Biol 2005  
Most recent: Manipulation of developing juvenile structures in purple sea urchins (Strongylocentrotus purpuratus) by morpholino injection into late stage larvae., PLoS One 2014                
View All Papers