Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506453

Morpholino Name: tbr1 MO2
Synonyms:
Target mRNA: tbr1

Morpholino Type: translation blocking morpholino
Sequence: 5' TCGCTTCAAAATCCTCACTCATCAT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
Publications
First: Larval mesenchyme cell specification in the primitive echinoid occurs independently of the double-negative gate., Development 2014  
Most recent:
View All Papers