Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506450

Morpholino Name: LOC100890997 MO1
Synonyms: Hp-unc-5 MASO
Target mRNA: LOC100890997

Morpholino Type: translation blocking morpholino
Sequence: 5' CGGCACTTCGGCGTCTCATCTTG 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
Publications
First: Unc-5/netrin-mediated axonal projection during larval serotonergic nervous system formation in the sea urchin, Hemicentrotus pulcherrimus., Int J Dev Biol 2013  
Most recent:
View All Papers