Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506447

Morpholino Name: sm30a MO1
Synonyms: MO_spsm30a
Target mRNA: sm30a

Morpholino Type: translation blocking morpholino
Sequence: 5' CCAACACATAGATGAAACCCCGCAT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 25/26
genomic

MO
5' ATGCGGGGTTTCATCTATGTGTTGG 3' ||||||||||||||||||||||||| 3' TACGCCCCAAAGTAGATACACAACC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145602.1:5065088..5065112 25/25 Antisense target sm30a
NW_022145602.1:5050649..5050673 24/25 Antisense off-target sm30b
NW_022145602.1:5024102..5024126 23/25 Antisense off-target sm30c
NW_022145602.1:5003191..5003215 21/25 Antisense off-target sm30f
NW_022145602.1:5043041..5043065 24/25 Antisense off-target LOC115925165
NW_022145602.1:5057524..5057548 24/25 Antisense off-target LOC115918256
Publications
First: SM30 protein function during sea urchin larval spicule formation., J Struct Biol 2013  
Most recent:
View All Papers