Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506444

Morpholino Name: prox1 MO2
Synonyms: Prox1-MASO2
Target mRNA: prox1

Morpholino Type: splice blocking morpholino
Sequence: 5' ACACCAAAAAGGACTTACCGTGAAC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 24/26
genomic

MO
5' ATTCACGGTAAGTCCTTTTTGGTGT 3' |||||||||||||||||||||||| 3' CAAGTGCCATTCAGGAAAAACCACA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145611.1:20027670..20027694 24/25 Antisense target prox1
NW_022145611.1:20068735..20068759 24/25 Antisense off-target LOC115917881
Publications
First: Diversification of oral and aboral mesodermal regulatory states in pregastrular sea urchin embryos., Dev Biol 2013  
Most recent:
View All Papers