Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506439

Morpholino Name: gata3 MO1
Synonyms: GataC-MASO
Target mRNA: gata3

Morpholino Type: translation blocking morpholino
Sequence: 5' CATTAAAAGAAAATAACAAGTTCAC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 25/25
genomic

MO
5' GTGAACTTGTTATTTTCTTTTAATG 3' ||||||||||||||||||||||||| 3' CACTTGAACAATAAAAGAAAATTAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145612.1:11521674..11521698 25/25 Antisense target gata3
NW_022145539.1:217184..217208 21/25 Sense off-target abcc5a
NW_022145580.1:901020..901044 21/25 Antisense off-target LOC590251
NW_022145595.1:25822116..25822140 21/25 Antisense off-target LOC582939
NW_022145599.1:32803609..32803633 21/25 Antisense off-target LOC587846
NW_022145600.1:11394378..11394402 21/25 Antisense off-target LOC586779
NW_022145570.1:2013271..2013295 21/25 Antisense off-target LOC115929591
NW_022145605.1:339489..339513 21/25 Sense off-target LOC105443677
NW_022145612.1:3736575..3736599 21/25 Sense off-target LOC105445948
NW_022145613.1:880433..880457 21/25 Antisense off-target LOC115917904
NW_022145606.1:21669442..21669466 22/25 unknown
NW_022145605.1:9372713..9372737 21/25 unknown
Publications
First: Diversification of oral and aboral mesodermal regulatory states in pregastrular sea urchin embryos., Dev Biol 2013  
Most recent:
View All Papers