Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506436

Morpholino Name: ccnb2 MO5
Synonyms: sfcycB MO
Target mRNA: ccnb2

Morpholino Type: translation blocking morpholino
Sequence: 5' ATTTCCATTTAACTTTTATTTACAA 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145601.1:16570745..16570769 21/25 1 Sense off-target pde6d
NW_022145606.1:26233400..26233424 22/25 2 Antisense off-target ankrd28l
NW_022145600.1:24653945..24653969 21/25 3 Antisense off-target LOC764451
NW_022145610.1:13946418..13946442 21/25 4 Antisense off-target LOC585901
NW_022145610.1:18024267..18024291 21/25 5 Antisense off-target LOC579727
NW_022145615.1:21933962..21933986 21/25 6 Sense off-target LOC578960
NW_022145598.1:21770197..21770221 22/25 7 Sense off-target LOC100893748
NW_022145594.1:30428665..30428689 21/25 8 Antisense off-target LOC105443456
NW_022145594.1:30829326..30829350 21/25 9 Antisense off-target LOC105440660
NW_022145599.1:530022..530046 21/25 10 Antisense off-target LOC115923739
NW_022145610.1:18701587..18701611 21/25 11 Antisense off-target LOC115929339
NW_022145615.1:31468419..31468443 21/25 12 Sense off-target LOC100889704
NW_022145603.1:15160819..15160843 22/25 13 unknown
NW_022145606.1:34855835..34855859 22/25 14 unknown
NW_022145612.1:8381988..8382012 22/25 15 unknown
NW_022145575.1:1910198..1910222 21/25 16 unknown
NW_022145595.1:18549352..18549376 21/25 17 unknown
NW_022145596.1:12843359..12843383 21/25 18 unknown
NW_022145606.1:6293321..6293345 21/25 19 unknown
NW_022145607.1:27632575..27632599 21/25 20 unknown
NW_022145607.1:28635418..28635442 21/25 21 unknown
NW_022145607.1:7119593..7119617 21/25 22 unknown
NW_022145612.1:9712334..9712358 21/25 23 unknown
NW_022145614.1:4713670..4713694 21/25 24 unknown
NW_022145615.1:8856681..8856705 21/25 25 unknown
Publications
First: Antisense morpholino targeting just upstream from a poly(A) tail junction of maternal mRNA removes the tail and inhibits translation., Nucleic Acids Res 2012              
Most recent:
View All Papers