Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506435

Morpholino Name: ccna2 MO2
Synonyms: sfcycA MO
Target mRNA: ccna2

Morpholino Type: translation blocking morpholino
Sequence: 5' ACATTAAAATGTTTTTATTACGAT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145603.1:16593065..16593088 20/24 1 Antisense off-target pax6
NW_022145609.1:22160089..22160112 20/24 2 Sense off-target wdr78
NW_022145614.1:28663902..28663925 20/24 3 Antisense off-target vps35
NW_022145605.1:18979759..18979782 20/24 4 Sense off-target LOC577163
NW_022145606.1:2444740..2444763 20/24 5 Antisense off-target LOC756355
NW_022145606.1:2820063..2820086 20/24 6 Antisense off-target LOC578556
NW_022145609.1:26350468..26350491 20/24 7 Sense off-target LOC578541
NW_022145612.1:53106763..53106786 20/24 8 Antisense off-target LOC574893
NW_022145612.1:57858760..57858783 20/24 9 Sense off-target LOC580874
NW_022145603.1:25522076..25522099 21/24 10 Sense off-target LOC105443580
NW_022145609.1:17319334..17319357 21/24 11 Sense off-target LOC100889966
NW_022145516.1:484765..484788 20/24 12 Antisense off-target LOC115921100
NW_022145595.1:17528117..17528140 20/24 13 Sense off-target LOC105443243
NW_022145597.1:8424819..8424842 20/24 14 Antisense off-target LOC105441958
NW_022145602.1:1531759..1531782 20/24 15 Antisense off-target LOC100890947
NW_022145609.1:26781787..26781810 20/24 16 Sense off-target LOC105446396
NW_022145612.1:47021560..47021583 20/24 17 Antisense off-target LOC115929911
NW_022145612.1:56884038..56884061 20/24 18 Sense off-target LOC115919160
NW_022145596.1:11265867..11265890 21/24 19 unknown
NW_022145596.1:2354903..2354926 21/24 20 unknown
NW_022145539.1:389852..389875 20/24 21 unknown
NW_022145539.1:743257..743280 20/24 22 unknown
NW_022145545.1:556279..556302 20/24 23 unknown
NW_022145596.1:16155787..16155810 20/24 24 unknown
NW_022145599.1:6121843..6121866 20/24 25 unknown
NW_022145600.1:28379552..28379575 20/24 26 unknown
NW_022145601.1:29766356..29766379 20/24 27 unknown
NW_022145602.1:13819803..13819826 20/24 28 unknown
NW_022145605.1:18521237..18521260 20/24 29 unknown
NW_022145609.1:16933980..16934003 20/24 30 unknown
NW_022145610.1:16217658..16217681 20/24 31 unknown
NW_022145610.1:29615624..29615647 20/24 32 unknown
NW_022145610.1:30303715..30303738 20/24 33 unknown
NW_022145613.1:29051611..29051634 20/24 34 unknown
NW_022145615.1:33117970..33117993 20/24 35 unknown
Publications
First: Antisense morpholino targeting just upstream from a poly(A) tail junction of maternal mRNA removes the tail and inhibits translation., Nucleic Acids Res 2012              
Most recent:
View All Papers