Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506432

Morpholino Name: ccnb2 MO3
Synonyms: cyclin B1 MO
Target mRNA: ccnb2

Morpholino Type: translation blocking morpholino
Sequence: 5' AAAACTTTAAAAAGTTTATTTGAAT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145613.1:460096..460120 21/25 Antisense off-target Sdc
NW_022145601.1:23338552..23338576 21/25 Antisense off-target hspg2
NW_022145601.1:2933915..2933939 21/25 Antisense off-target clcn2
NW_022145604.1:20940675..20940699 21/25 Antisense off-target med16
NW_022145607.1:19769059..19769083 21/25 Antisense off-target sf3a3
NW_022145612.1:27068425..27068449 21/25 Sense off-target dnah6
NW_022145525.1:347329..347353 21/25 Sense off-target LOC373274
NW_022145609.1:28376925..28376949 21/25 Sense off-target LOC753250
NW_022145612.1:9873715..9873739 21/25 Sense off-target LOC574572
NW_022145614.1:5335025..5335049 21/25 Sense off-target LOC590618
NW_022145615.1:5488802..5488826 21/25 Antisense off-target LOC581935
NW_022145604.1:14582917..14582941 21/25 Antisense off-target LOC115918781
NW_022145611.1:38490738..38490762 21/25 Antisense off-target LOC105439525
NW_022145611.1:40737204..40737228 21/25 Antisense off-target LOC115929701
NW_022145611.1:43628493..43628517 21/25 Antisense off-target LOC100891430
NW_022145613.1:38938912..38938936 21/25 Antisense off-target LOC115918346
NW_022145613.1:39070022..39070046 21/25 Antisense off-target LOC100891289
NW_022145614.1:32540558..32540582 21/25 Antisense off-target LOC105437505
NW_022145614.1:33049207..33049231 21/25 Antisense off-target LOC105444112
NW_022145615.1:16319593..16319617 21/25 Sense off-target LOC105446079
NW_022145600.1:34013279..34013303 22/25 unknown
NW_022145601.1:16635131..16635155 22/25 unknown
NW_022145605.1:15944513..15944537 22/25 unknown
NW_022145594.1:13875347..13875371 21/25 unknown
NW_022145596.1:19076274..19076298 21/25 unknown
NW_022145602.1:1133305..1133329 21/25 unknown
NW_022145603.1:25817570..25817594 21/25 unknown
NW_022145609.1:18633926..18633950 21/25 unknown
NW_022145610.1:6350327..6350351 21/25 unknown
NW_022145611.1:22037225..22037249 21/25 unknown
NW_022145612.1:58285961..58285985 21/25 unknown
Publications
First: Antisense morpholino targeting just upstream from a poly(A) tail junction of maternal mRNA removes the tail and inhibits translation., Nucleic Acids Res 2012              
Most recent:
View All Papers