Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506426

Morpholino Name: cdk9 MO4
Synonyms: cdk9 MO-4
Target mRNA: cdk9

Morpholino Type: translation blocking morpholino
Sequence: 5' ACAAATAAAAACATCTTTAAAAATA 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145615.1:25678978..25679002 22/25 Sense off-target rx1
NW_022145611.1:4974231..4974255 21/25 Antisense off-target alk
NW_022145598.1:16062145..16062169 22/25 Antisense off-target ptk2
NW_022145596.1:16438152..16438176 21/25 Sense off-target taf7
NW_022145613.1:21307092..21307116 21/25 Antisense off-target klf6
NW_022145596.1:12401818..12401842 21/25 Sense off-target glyr1
NW_022145596.1:735861..735885 21/25 Sense off-target fbxl3
NW_022145596.1:8702323..8702347 21/25 Antisense off-target micu3
NW_022145614.1:27725447..27725471 21/25 Antisense off-target relch
NW_022145600.1:17613110..17613134 23/25 Antisense off-target prom1l
NW_022145606.1:17650116..17650140 21/25 Sense off-target pkmyt1
NW_022145599.1:3585349..3585373 21/25 Antisense off-target znf207
NW_022145609.1:11876740..11876764 21/25 Sense off-target lmbrd2
NW_022145610.1:31921303..31921327 21/25 Antisense off-target nup188
NW_022145597.1:18247026..18247050 21/25 Antisense off-target ppp2r3b
NW_022145604.1:19190847..19190871 23/25 Antisense off-target LOC373364
NW_022145607.1:36104922..36104946 23/25 Antisense off-target LOC583697
NW_022145605.1:5017729..5017753 22/25 Antisense off-target LOC592133
NW_022145595.1:15150957..15150981 22/25 Antisense off-target LOC589757
NW_022145600.1:18502746..18502770 22/25 Antisense off-target LOC763292
NW_022145601.1:9047750..9047774 22/25 Antisense off-target LOC580262
NW_022145602.1:27431247..27431271 22/25 Antisense off-target LOC589178
NW_022145615.1:32692244..32692268 22/25 Sense off-target LOC587404
NW_022145615.1:7687291..7687315 22/25 Sense off-target LOC591955
NW_022145605.1:29969437..29969461 21/25 Sense off-target LOC589283
NW_022145605.1:31734898..31734922 21/25 Sense off-target LOC591890
NW_022145506.1:25041..25065 21/25 Antisense off-target LOC574978
NW_022145558.1:133174..133198 21/25 Antisense off-target LOC592772
NW_022145578.1:321163..321187 21/25 Antisense off-target LOC752233
NW_022145596.1:13685053..13685077 21/25 Antisense off-target LOC578304
NW_022145596.1:24904047..24904071 21/25 Antisense off-target LOC587092
NW_022145597.1:13949916..13949940 21/25 Antisense off-target LOC579053
NW_022145600.1:2632356..2632380 21/25 Antisense off-target LOC591027
NW_022145607.1:22960652..22960676 21/25 Antisense off-target LOC590527
NW_022145610.1:24474795..24474819 21/25 Antisense off-target LOC592191
NW_022145610.1:26859694..26859718 21/25 Antisense off-target LOC580206
NW_022145612.1:34210684..34210708 21/25 Sense off-target LOC586400
NW_022145612.1:43805844..43805868 21/25 Sense off-target LOC578241
NW_022145612.1:55693573..55693597 21/25 Antisense off-target LOC577362
NW_022145605.1:4441299..4441323 22/25 Antisense off-target LOC105443134
NW_022145545.1:154074..154098 22/25 Sense off-target LOC105444851
NW_022145597.1:10915398..10915422 22/25 Antisense off-target LOC105438062
NW_022145597.1:12404565..12404589 22/25 Antisense off-target LOC100888914
NW_022145606.1:15888938..15888962 21/25 Antisense off-target LOC105443449
NW_022145530.1:497420..497444 21/25 Antisense off-target LOC115922771
NW_022145553.1:247907..247931 21/25 Antisense off-target LOC115926788
NW_022145596.1:22418849..22418873 21/25 Sense off-target LOC115922114
NW_022145598.1:16769913..16769937 21/25 Antisense off-target LOC100890089
NW_022145598.1:7679410..7679434 21/25 Antisense off-target LOC105447429
NW_022145600.1:1551453..1551477 21/25 Sense off-target LOC100892710
NW_022145600.1:386574..386598 21/25 Antisense off-target LOC100889247
NW_022145602.1:12592681..12592705 21/25 Antisense off-target LOC100889066
NW_022145606.1:35833705..35833729 21/25 Sense off-target LOC105437952
NW_022145606.1:44462444..44462468 21/25 Antisense off-target LOC105441598
NW_022145607.1:16577179..16577203 21/25 Antisense off-target LOC115928214
NW_022145607.1:41701479..41701503 21/25 Antisense off-target LOC115928096
NW_022145610.1:25093876..25093900 21/25 Antisense off-target LOC115929178
NW_022145611.1:4048634..4048658 21/25 Antisense off-target LOC115929526
NW_022145612.1:29761921..29761945 21/25 Sense off-target LOC100892183
NW_022145614.1:26485592..26485616 21/25 Antisense off-target LOC105442306
NW_022145615.1:20810019..20810043 21/25 Sense off-target LOC100890654
NW_022145606.1:28152619..28152643 22/25 unknown
NW_022145595.1:10713597..10713621 22/25 unknown
NW_022145595.1:4635040..4635064 22/25 unknown
NW_022145596.1:23435658..23435682 22/25 unknown
NW_022145598.1:10892694..10892718 22/25 unknown
NW_022145600.1:20485324..20485348 22/25 unknown
NW_022145600.1:25156229..25156253 22/25 unknown
NW_022145600.1:5498990..5499014 22/25 unknown
NW_022145602.1:27455344..27455368 22/25 unknown
NW_022145606.1:11628292..11628316 21/25 unknown
NW_022145606.1:11633109..11633133 21/25 unknown
NW_022145606.1:15876761..15876785 21/25 unknown
NW_022145139.1:30223..30247 21/25 unknown
NW_022145516.1:118457..118481 21/25 unknown
NW_022145516.1:38287..38311 21/25 unknown
NW_022145541.1:1007678..1007702 21/25 unknown
NW_022145560.1:292267..292291 21/25 unknown
NW_022145572.1:1023212..1023236 21/25 unknown
NW_022145572.1:832293..832317 21/25 unknown
NW_022145575.1:648227..648251 21/25 unknown
NW_022145594.1:36979077..36979101 21/25 unknown
NW_022145594.1:40534554..40534578 21/25 unknown
NW_022145594.1:41154968..41154992 21/25 unknown
NW_022145594.1:56982..57006 21/25 unknown
NW_022145595.1:2934685..2934709 21/25 unknown
NW_022145595.1:7343581..7343605 21/25 unknown
NW_022145597.1:11742595..11742619 21/25 unknown
NW_022145597.1:32602746..32602770 21/25 unknown
NW_022145597.1:4823548..4823572 21/25 unknown
NW_022145598.1:10882588..10882612 21/25 unknown
NW_022145598.1:11365977..11366001 21/25 unknown
NW_022145598.1:15378362..15378386 21/25 unknown
NW_022145598.1:19383781..19383805 21/25 unknown
NW_022145598.1:19432355..19432379 21/25 unknown
NW_022145598.1:32674980..32675004 21/25 unknown
NW_022145598.1:32909014..32909038 21/25 unknown
NW_022145599.1:16473307..16473331 21/25 unknown
NW_022145599.1:23222397..23222421 21/25 unknown
NW_022145600.1:12365836..12365860 21/25 unknown
NW_022145600.1:13902707..13902731 21/25 unknown
NW_022145600.1:18577490..18577514 21/25 unknown
NW_022145600.1:37094016..37094040 21/25 unknown
NW_022145600.1:5509479..5509503 21/25 unknown
NW_022145601.1:5714302..5714326 21/25 unknown
NW_022145602.1:22692930..22692954 21/25 unknown
NW_022145603.1:12521314..12521338 21/25 unknown
NW_022145603.1:14567710..14567734 21/25 unknown
NW_022145603.1:25054728..25054752 21/25 unknown
NW_022145604.1:17487600..17487624 21/25 unknown
NW_022145604.1:8210478..8210502 21/25 unknown
NW_022145605.1:27077008..27077032 21/25 unknown
NW_022145606.1:32587196..32587220 21/25 unknown
NW_022145606.1:45763337..45763361 21/25 unknown
NW_022145607.1:33286954..33286978 21/25 unknown
NW_022145609.1:10646765..10646789 21/25 unknown
NW_022145610.1:15894966..15894990 21/25 unknown
NW_022145610.1:34540690..34540714 21/25 unknown
NW_022145611.1:41967685..41967709 21/25 unknown
NW_022145611.1:5592640..5592664 21/25 unknown
NW_022145612.1:13605381..13605405 21/25 unknown
NW_022145612.1:1913807..1913831 21/25 unknown
NW_022145612.1:26158172..26158196 21/25 unknown
NW_022145612.1:38177520..38177544 21/25 unknown
NW_022145615.1:26519183..26519207 21/25 unknown
NW_022145615.1:6843637..6843661 21/25 unknown
NW_022145615.1:7052933..7052957 21/25 unknown
Publications
First: Antisense morpholino targeting just upstream from a poly(A) tail junction of maternal mRNA removes the tail and inhibits translation., Nucleic Acids Res 2012              
Most recent:
View All Papers