Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506424

Morpholino Name: cdk9 MO2
Synonyms: cdk9 MO-2
Target mRNA: cdk9

Morpholino Type: translation blocking morpholino
Sequence: 5' ATTTATACTTATACAAGTAACAAAC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145604.1:977907..977931 21/25 Antisense off-target sfe9
NW_022145599.1:7066902..7066926 21/25 Antisense off-target slc39a11
NW_022145612.1:29822890..29822914 21/25 Sense off-target LOC593724
NW_022145594.1:10619210..10619234 21/25 unknown
NW_022145603.1:28253660..28253684 21/25 unknown
NW_022145604.1:1566444..1566468 21/25 unknown
Publications
First: Antisense morpholino targeting just upstream from a poly(A) tail junction of maternal mRNA removes the tail and inhibits translation., Nucleic Acids Res 2012              
Most recent:
View All Papers