Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506417

Morpholino Name: zeb2 MO1
Synonyms: Zfhx1/Z81-MO1
Target mRNA: zeb2

Morpholino Type: translation blocking morpholino
Sequence: 5' ACGTAGGTATGTTCCAAAACACAAG 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145612.1:44078946..44078970 25/25 Antisense off-target LOC594820
NW_022145612.1:44049160..44049184 25/25 unknown
Publications
First: Zinc finger homeobox is required for the differentiation of serotonergic neurons in the sea urchin embryo., Dev Biol 2012  
Most recent:
View All Papers