Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506310

Morpholino Name: wnt8a MO6
Synonyms: wnt8 Mo2
Target mRNA: wnt8a

Morpholino Type: translation blocking morpholino
Sequence: 5' AACAGTCCAAATATGAAGTTCAAAC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145611.1:22964459..22964483 21/25 Sense off-target LOC580234
NW_022145603.1:29436568..29436592 21/25 Sense off-target LOC115925555
NW_022145603.1:29632634..29632658 21/25 Sense off-target LOC105439203
Publications
First: Ancestral regulatory circuits governing ectoderm patterning downstream of Nodal and BMP2/4 revealed by gene regulatory network analysis in an echinoderm., PLoS Genet 2010                        
Most recent:
View All Papers