Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506272

Morpholino Name: foxe3l MO3
Synonyms:
Target mRNA: foxe3l

Morpholino Type: translation blocking morpholino
Sequence: 5' TCATGATGAAATGTTGGAACGAGAG 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145598.1:22859313..22859337 22/25 Sense off-target src
NW_022145599.1:2399913..2399937 25/25 Sense off-target LOC583176
NW_022145599.1:2399913..2399937 25/25 Antisense off-target LOC583193
NW_022145610.1:30433365..30433389 21/25 Sense off-target LOC115929009
NW_022145610.1:30636491..30636515 21/25 Sense off-target LOC100893129
Publications
First: ankAT-1 is a novel gene mediating the apical tuft formation in the sea urchin embryo., Dev Biol 2010  
Most recent:
View All Papers