Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506265

Morpholino Name: LOC100893238 MO1
Synonyms:
Target mRNA: LOC100893238

Morpholino Type: translation blocking morpholino
Sequence: 5' GTGTTTGGTGTGGCTACTGCAGTC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145610.1:5717391..5717414 20/24 Sense off-target dnmt1
NW_022145611.1:34793427..34793450 20/24 Sense off-target adck1
NW_022145607.1:39477201..39477224 21/24 Antisense off-target ldlrap1
NW_022145597.1:7079474..7079497 20/24 Antisense off-target tubgcp3
NW_022145596.1:12824031..12824054 20/24 Sense off-target LOC578224
NW_022145604.1:26098107..26098130 20/24 Sense off-target LOC752954
NW_022145613.1:25968120..25968143 22/24 Antisense off-target LOC105437222
NW_022145519.1:232218..232241 20/24 Antisense off-target LOC115921474
NW_022145531.1:47224..47247 20/24 Antisense off-target LOC100892924
NW_022145566.1:1068225..1068248 20/24 Antisense off-target LOC115929329
NW_022145567.1:206397..206420 20/24 Antisense off-target LOC105437319
NW_022145575.1:562924..562947 20/24 Antisense off-target LOC115919818
NW_022145597.1:2048727..2048750 20/24 Antisense off-target LOC115922815
NW_022145601.1:27461672..27461695 20/24 Antisense off-target LOC115924727
NW_022145603.1:1249717..1249740 20/24 Sense off-target LOC105440818
NW_022145604.1:17568523..17568546 20/24 Antisense off-target LOC115925830
NW_022145609.1:37644916..37644939 20/24 Antisense off-target LOC115928578
NW_022145612.1:46480611..46480634 20/24 Antisense off-target LOC100892044
NW_022145595.1:965045..965068 20/24 unknown
NW_022145606.1:3889016..3889039 20/24 unknown
NW_022145607.1:27917244..27917267 20/24 unknown
NW_022145611.1:1098592..1098615 20/24 unknown
Publications
First: HpSulf, a heparan sulfate 6-O-endosulfatase, is involved in the regulation of VEGF signaling during sea urchin development., Mech Dev 2010  
Most recent:
View All Papers