Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506262

Morpholino Name: LOC115919123 MO1
Synonyms:
Target mRNA: LOC115919123

Morpholino Type: translation blocking morpholino
Sequence: 5' TAATCGTTGAAAGGGTCGTACATGC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 24/25
genomic

MO
5' CCATGTACGACCCTTTCAACGATTA 3' |||||||||||||||||||||||| 3' CGTACATGCTGGGAAAGTTGCTAAT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145456.1:25924..25948 24/25 Antisense target LOC115919123
NW_022145456.1:32..56 24/25 Antisense target LOC115919123
NW_022145605.1:14906656..14906680 24/25 Antisense off-target nanos2l
NW_022145612.1:12618102..12618126 24/25 Antisense off-target LOC754101
NW_022145612.1:12618102..12618126 24/25 Antisense off-target LOC100893245
Publications
First: Role of the nanos homolog during sea urchin development., Dev Dyn 2009  
Most recent:
View All Papers