Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506261

Morpholino Name: LOC575336 MO1
Synonyms:
Target mRNA: LOC575336

Morpholino Type: translation blocking morpholino
Sequence: 5' TACTTCAGGCGGGGAAGGAAAAGG 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145611.1:30537314..30537337 20/24 Antisense off-target LOC586399
Publications
First: Sea urchin arylsulfatase, an extracellular matrix component, is involved in gastrulation during embryogenesis., Dev Genes Evol 2009  
Most recent:
View All Papers