Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506246

Morpholino Name: gscl MO2
Synonyms:
Target mRNA: gscl

Morpholino Type: translation blocking morpholino
Sequence: 5' AGAAACAGAGAGCTGACCACTATGA 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 25/25
genomic

MO
5' TCATAGTGGTCAGCTCTCTGTTTCT 3' ||||||||||||||||||||||||| 3' AGTATCACCAGTCGAGAGACAAAGA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145611.1:20181983..20182007 25/25 Antisense target gscl
NW_022145613.1:2583437..2583461 21/25 Antisense off-target LOC582035
NW_022145612.1:61011906..61011930 22/25 Antisense off-target LOC115919334
NW_022145611.1:7077048..7077072 21/25 unknown
NW_022145611.1:7081600..7081624 21/25 unknown
NW_022145611.1:7086153..7086177 21/25 unknown
Publications
First: A perturbation model of the gene regulatory network for oral and aboral ectoderm specification in the sea urchin embryo., Dev Biol 2009  
Most recent:
View All Papers