Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506240

Morpholino Name: arid3a MO3
Synonyms:
Target mRNA: arid3a

Morpholino Type: translation blocking morpholino
Sequence: 5' CTGTCTTCGCTGGTCTTCAACC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 22/22
genomic

MO
5' GGTTGAAGACCAGCGAAGACAG 3' |||||||||||||||||||||| 3' CCAACTTCTGGTCGCTTCTGTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145615.1:18484512..18484533 22/22 Antisense target arid3a
NW_022145599.1:321664..321685 18/22 Sense off-target shmt1
NW_022145607.1:33445524..33445545 18/22 Sense off-target prdm1
NW_022145594.1:23411775..23411796 18/22 Antisense off-target LOC577692
NW_022145607.1:1877..1898 18/22 Sense off-target blimp1/krox
NW_022145594.1:22773987..22774008 18/22 Antisense off-target LOC105445097
Publications
First: A perturbation model of the gene regulatory network for oral and aboral ectoderm specification in the sea urchin embryo., Dev Biol 2009  
Most recent:
View All Papers