Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506236

Morpholino Name: zfhx4 MO1
Synonyms:
Target mRNA: zfhx4

Morpholino Type: translation blocking morpholino
Sequence: 5' TCTCATCATCTTTGTTGTCCTGTAG 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 24/25
genomic

MO
5' CTACAGGACAACAAAGAGGATGAGA 3' ||||||||||||||||| ||||||| 3' GATGTCCTGTTGTTTCTACTACTCT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145614.1:1020303..1020327 24/25 Antisense target zfhx4
NW_022145596.1:12614720..12614744 21/25 Sense off-target LOC587217
NW_022145596.1:20198423..20198447 21/25 Sense off-target LOC576655
NW_022145607.1:34248990..34249014 21/25 Sense off-target LOC581301
NW_022145596.1:22416988..22417012 21/25 Sense off-target LOC115922114
NW_022145564.1:142124..142148 21/25 unknown
NW_022145594.1:51210735..51210759 21/25 unknown
NW_022145595.1:20384611..20384635 21/25 unknown
Publications
First: A perturbation model of the gene regulatory network for oral and aboral ectoderm specification in the sea urchin embryo., Dev Biol 2009  
Most recent:
View All Papers