Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506235

Morpholino Name: LOC576509 MO1
Synonyms: Hpnetrin MO
Target mRNA: LOC576509

Morpholino Type: translation blocking morpholino
Sequence: 5' GACTCACAATTTGCATTTTACCTTC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145605.1:34494953..34494977 21/25 Antisense off-target b3glct
NW_022145596.1:30424835..30424859 21/25 Antisense off-target LOC752487
Publications
First: Spatio-temporal expression of a Netrin homolog in the sea urchin Hemicentrotus pulcherrimus (HpNetrin) during serotonergic axon extension., Int J Dev Biol 2008  
Most recent:
View All Papers