Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506214

Morpholino Name: arid3a MO2
Synonyms:
Target mRNA: arid3a

Morpholino Type: translation blocking morpholino
Sequence: 5' CTGTCTTCGCTGGTTCTTCAAC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145598.1:27443382..27443403 19/22 Antisense off-target rab10
NW_022145601.1:34780080..34780101 19/22 Sense off-target LOC584296
NW_022145604.1:22350156..22350177 18/22 Sense off-target LOC592613
NW_022145594.1:5755012..5755033 19/22 Sense off-target LOC115918414
NW_022145612.1:9230700..9230721 18/22 Sense off-target LOC105437565
NW_022145554.1:1349622..1349643 19/22 unknown
NW_022145594.1:7736112..7736133 19/22 unknown
NW_022145605.1:38289366..38289387 19/22 unknown
NW_022145605.1:38331180..38331201 19/22 unknown
Publications
First: Global regulatory logic for specification of an embryonic cell lineage., Proc Natl Acad Sci U S A 2008  
Most recent:
View All Papers