Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506203

Morpholino Name: foxa1 MO1
Synonyms:
Target mRNA: foxa1

Morpholino Type: translation blocking morpholino
Sequence: 5' TGGGTTCCTCTTTGAAATCCACGAT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 25/25
genomic

MO
5' ATCGTGGATTTCAAAGAGGAACCCA 3' ||||||||||||||||||||||||| 3' TAGCACCTAAAGTTTCTCCTTGGGT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145611.1:31438870..31438894 25/25 Antisense target foxa1
Publications
First: Repression of mesodermal fate by foxa, a key endoderm regulator of the sea urchin embryo., Development 2006  
Most recent: Specific functions of the Wnt signaling system in gene regulatory networks throughout the early sea urchin embryo., Proc Natl Acad Sci U S A 2014  
View All Papers