Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506200

Morpholino Name: wnt8a MO4
Synonyms: LvWnt8MO1
Target mRNA: wnt8a

Morpholino Type: translation blocking morpholino
Sequence: 5' TAAAAATCAAGTATAAAGTCACA 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145597.1:27103506..27103528 19/23 Sense off-target gfm1
NW_022145614.1:27228388..27228410 19/23 Sense off-target rab2a
NW_022145599.1:6328175..6328197 20/23 Sense off-target mad1l1
NW_022145595.1:26539538..26539560 19/23 Antisense off-target LOC756397
NW_022145530.1:563501..563523 19/23 Antisense off-target LOC592745
NW_022145601.1:24879988..24880010 19/23 Antisense off-target LOC762614
NW_022145613.1:8026849..8026871 19/23 Antisense off-target LOC583297
NW_022145595.1:10474098..10474120 20/23 Antisense off-target LOC105437926
NW_022145609.1:28517949..28517971 20/23 Antisense off-target LOC100893195
NW_022145595.1:21020249..21020271 19/23 Antisense off-target LOC105441882
NW_022145595.1:21021690..21021712 19/23 Antisense off-target LOC105441882
NW_022145597.1:2535591..2535613 19/23 Antisense off-target LOC115922818
NW_022145598.1:7641891..7641913 19/23 Antisense off-target LOC105447429
NW_022145610.1:14118104..14118126 19/23 Antisense off-target LOC105438852
NW_022145551.1:1687363..1687385 21/23 unknown
NW_022145570.1:860061..860083 21/23 unknown
NW_022145602.1:2919469..2919491 21/23 unknown
NW_022145595.1:11972114..11972136 20/23 unknown
NW_022145599.1:31262520..31262542 20/23 unknown
NW_022145526.1:371410..371432 20/23 unknown
NW_022145526.1:374713..374735 20/23 unknown
NW_022145570.1:451262..451284 20/23 unknown
NW_022145594.1:36007078..36007100 20/23 unknown
NW_022145594.1:46979379..46979401 20/23 unknown
NW_022145595.1:10481380..10481402 20/23 unknown
NW_022145595.1:11564214..11564236 20/23 unknown
NW_022145604.1:2244004..2244026 20/23 unknown
NW_022145612.1:28687281..28687303 20/23 unknown
NW_022145613.1:14511671..14511693 20/23 unknown
NW_022145613.1:16593796..16593818 20/23 unknown
NW_022145615.1:11159126..11159148 20/23 unknown
NW_022145615.1:20346660..20346682 20/23 unknown
NW_022145600.1:32669544..32669566 19/23 unknown
NW_022145595.1:21734588..21734610 19/23 unknown
NW_022145596.1:18649810..18649832 19/23 unknown
NW_022145597.1:2434820..2434842 19/23 unknown
NW_022145597.1:28818828..28818850 19/23 unknown
NW_022145598.1:973106..973128 19/23 unknown
NW_022145599.1:33858128..33858150 19/23 unknown
NW_022144810.1:5839..5861 19/23 unknown
NW_022145526.1:722374..722396 19/23 unknown
NW_022145526.1:723119..723141 19/23 unknown
NW_022145550.1:1463648..1463670 19/23 unknown
NW_022145560.1:661051..661073 19/23 unknown
NW_022145570.1:2755752..2755774 19/23 unknown
NW_022145575.1:2347402..2347424 19/23 unknown
NW_022145594.1:51938377..51938399 19/23 unknown
NW_022145601.1:18021011..18021033 19/23 unknown
NW_022145601.1:30142838..30142860 19/23 unknown
NW_022145606.1:13718322..13718344 19/23 unknown
NW_022145606.1:13719067..13719089 19/23 unknown
NW_022145606.1:13867737..13867759 19/23 unknown
NW_022145606.1:13868461..13868483 19/23 unknown
NW_022145606.1:4444919..4444941 19/23 unknown
NW_022145606.1:46156528..46156550 19/23 unknown
NW_022145606.1:52246031..52246053 19/23 unknown
NW_022145607.1:3415926..3415948 19/23 unknown
NW_022145611.1:12978278..12978300 19/23 unknown
NW_022145612.1:23923309..23923331 19/23 unknown
NW_022145615.1:16551176..16551198 19/23 unknown
NW_022145615.1:16551212..16551234 19/23 unknown
NW_022145615.1:22751611..22751633 19/23 unknown
Publications
First: Nuclear beta-catenin-dependent Wnt8 signaling in vegetal cells of the early sea urchin embryo regulates gastrulation and differentiation of endoderm and mesodermal cell lineages., Genesis 2004  
Most recent:
View All Papers