Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506197

Morpholino Name: runx2 MO3
Synonyms:
Target mRNA: runx2

Morpholino Type: translation blocking morpholino
Sequence: 5' TAACTGTTATGTAGGTTGTTCCTCC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145607.1:7879245..7879269 25/25 1 unknown
Publications
First: Evaluation of developmental phenotypes produced by morpholino antisense targeting of a sea urchin Runx gene., BMC Biol 2004        
Most recent:
View All Papers