Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506194

Morpholino Name: nkx2-1 MO2
Synonyms: SpNK2.1 MASO
Target mRNA: nkx2-1

Morpholino Type: translation blocking morpholino
Sequence: 5' GGGCTATATGACATCTCTTGGAGA 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 22/24
genomic

MO
5' CTTCCAAGAGATGTCATATAGCCC 3' |||||||||||||||||||||| 3' AGAGGTTCTCTACAGTATATCGGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145611.1:17971636..17971659 22/24 Antisense target nkx2-1
NW_022145570.1:108189..108212 20/24 Sense off-target LOC115929530
NW_022145599.1:30887674..30887697 20/24 unknown
Publications
First: Expression of an NK2 homeodomain gene in the apical ectoderm defines a new territory in the early sea urchin embryo., Dev Biol 2004  
Most recent:
View All Papers