Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506188

Morpholino Name: sox14 MO4
Synonyms:
Target mRNA: sox14

Morpholino Type: translation blocking morpholino
Sequence: 5' CCCCATCGCAGAGTCCATCATCATC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 24/25
genomic

MO
5' CATGATGATGGACTCTGCGATGGGG 3' |||||||||||||||||||||||| 3' CTACTACTACCTGAGACGCTACCCC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145597.1:22023795..22023819 24/25 Antisense target sox14
NW_022145526.1:1706269..1706293 21/25 Antisense off-target xfinl1
NW_022145594.1:5118764..5118788 21/25 Antisense off-target LOC585963
NW_022145604.1:22580275..22580299 21/25 Sense off-target LOC583194
NW_022145606.1:15230266..15230290 21/25 Antisense off-target LOC100888163
Publications
First: Tight regulation of SpSoxB factors is required for patterning and morphogenesis in sea urchin embryos., Dev Biol 2003  
Most recent:
View All Papers