Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506182

Morpholino Name: LOC373243 MO1
Synonyms: MKrl-1
Target mRNA: LOC373243

Morpholino Type: translation blocking morpholino
Sequence: 5' CGTGATGCTGAATGGCAGTGGAGAC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 24/25
genomic

MO
5' GTCTCCACTGCCTTTCAGCATCACG 3' |||||||||||| |||||||||||| 3' CAGAGGTGACGGTAAGTCGTAGTGC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145604.1:21231378..21231402 24/25 Antisense target LOC373243
NW_022145604.1:21247029..21247053 23/25 Antisense off-target znf474
NW_022145604.1:21266606..21266630 23/25 Antisense off-target LOC100891209
Publications
First: SpKrl: a direct target of beta-catenin regulation required for endoderm differentiation in sea urchin embryos., Development 2001  
Most recent:
View All Papers