Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506180

Morpholino Name: LOC115922229 MO2
Synonyms: qbrick-MO2
Target mRNA: LOC115922229

Morpholino Type: translation blocking morpholino
Sequence: 5' GTCCAAGCCCAGAAGATGTGGTTAT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145609.1:4808747..4808771 24/25 Antisense off-target LOC591943
NW_022145547.1:1538393..1538417 24/25 Antisense off-target LOC115918736
Publications
First: Human disease-associated extracellular matrix orthologs ECM3 and QBRICK regulate primary mesenchymal cell migration in sea urchin embryos., Exp Anim 2021            
Most recent:
View All Papers