Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506174

Morpholino Name: irx4 MO1
Synonyms: irxA Mo1
Target mRNA: irx4

Morpholino Type: control morpholino
Sequence: 5' ATTGTGGATAACTGCTCGTCGTCAT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
Publications
First: Ancestral regulatory circuits governing ectoderm patterning downstream of Nodal and BMP2/4 revealed by gene regulatory network analysis in an echinoderm., PLoS Genet 2010                        
Most recent: Coup-TF: A maternal factor essential for differentiation along the embryonic axes in the sea urchin Paracentrotus lividus., Dev Biol 2021  
View All Papers