Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506171

Morpholino Name: nr2f2 MO1
Synonyms: Pl-Coup-TF MASO
Target mRNA: nr2f2

Morpholino Type: translation blocking morpholino
Sequence: 5' ACTGCGATGGCGTTGAGGGAATCGAT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 26/26
genomic

MO
5' ATCGATTCCCTCAACGCCATCGCAGT 3' |||||||||||||||||||||||||| 3' TAGCTAAGGGAGTTGCGGTAGCGTCA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145615.1:20933544..20933569 26/26 Antisense target nr2f2
Publications
First: Coup-TF: A maternal factor essential for differentiation along the embryonic axes in the sea urchin Paracentrotus lividus., Dev Biol 2021  
Most recent:
View All Papers