Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506142

Morpholino Name: LOC575163 MO1
Synonyms: ppTRPA1-CMO
Target mRNA: LOC575163

Morpholino Type: control morpholino
Sequence: 5' TACACTCATCGACCTCAATTACAAT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
Publications
First: Characterization of TRPA channels in the starfish Patiria pectinifera: involvement of thermally activated TRPA1 in thermotaxis in marine planktonic larvae., Sci Rep 2017                
Most recent:
View All Papers