Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506141

Morpholino Name: LOC503549 MO1
Synonyms:
Target mRNA: LOC503549

Morpholino Type: translation blocking morpholino
Sequence: 5' CTAATCCAGACGCCATATTGGAGTC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 25/25
genomic

MO
5' GACTCCAATATGGCGTCTGGATTAG 3' ||||||||||||||||||||||||| 3' CTGAGGTTATACCGCAGACCTAATC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145544.1:354729..354753 25/25 Antisense target LOC503549
NW_022145544.1:622..646 25/25 Antisense target LOC503549
NW_022145612.1:45949460..45949484 25/25 Antisense off-target LOC115919284
Publications
First: Sea urchin histamine receptor 1 regulates programmed cell death in larval Strongylocentrotus purpuratus., Sci Rep 2018                      
Most recent:
View All Papers