Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506138

Morpholino Name: LOC115929736 MO1
Synonyms: Hp-calaxin MO
Target mRNA: LOC115929736

Morpholino Type: translation blocking morpholino
Sequence: 5' CAGCATTCTTATTACTTCCTTTCAT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145575.1:366264..366288 24/25 Antisense off-target LOC115918337
Publications
First: Calaxin establishes basal body orientation and coordinates movement of monocilia in sea urchin embryos., Sci Rep 2017          
Most recent:
View All Papers