Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506115

Morpholino Name: six6 MO1
Synonyms:
Target mRNA: six6

Morpholino Type: translation blocking morpholino
Sequence: 5' CCCCGGTCGCTGGGCGATGTTTCTG 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 25/25
genomic

MO
5' CAGAAACATCGCCCAGCGACCGGGG 3' ||||||||||||||||||||||||| 3' GTCTTTGTAGCGGGTCGCTGGCCCC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145611.1:27891822..27891846 25/25 Antisense target six6
Publications
First: The sea urchin animal pole domain is a Six3-dependent neurogenic patterning center., Development 2009  
Most recent: Neurogenesis in sea urchin embryos and the diversity of deuterostome neurogenic mechanisms., Development 2016  
View All Papers